Top » Catalog » SNPs » A22305

$18.00

A22305
[A22305]

A22305
hg38 Position: ChrY:21301566..21301566
Ancestral: T
Derived: G
Reference: Floyd Owsley (2018)
ISOGG Haplogroup: R1b
Comments: Downstream BY4140
Forward Primer: A22305_F TACTAAAGGGAAAATTATTGCCACCTAC
Reverse Primer: A22305_R TCTTGGTTCATTATTTTCTAATTCATACTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies