Top » Catalog » SNPs » A22306

$18.00

A22306
[A22306]

A22306
hg38 Position: ChrY:19102511..19102511
Ancestral: C
Derived: G
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2a
Comments: Below Y3723
Forward Primer: A22306_F TCATAATGAGGGTGGTAGATTAAGTTAGTAG
Reverse Primer: A22306_R CTCCTGCAGGGATAAATATCCTAAC
Reviews

Customers who bought this product also purchased
L161.1
L161.1
A10514
A10514
CTS10228
CTS10228
A544
A544
BY92499
BY92499
I2a-M423 Panel
I2a-M423 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies