Top » Catalog » SNPs » A22312

$18.00

A22312
[A22312]

A22312
hg38 Position: ChrY:19136399..19136399
Ancestral: T
Derived: G
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments:
Forward Primer: A22312_F TAGAGTCAGAGTCTATCAAAATGATACAG
Reverse Primer: A22312_R TGGGGAAGAGACTTATTTTCAAC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Y5596
Y5596
A13912
A13912
A5874
A5874
A12505
A12505
A11115
A11115
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies