Top » Catalog » SNPs » A22312

$18.00

A22312
[A22312]

A22312
hg38 Position: ChrY:19136399..19136399
Ancestral: T
Derived: G
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments:
Forward Primer: A22312_F TAGAGTCAGAGTCTATCAAAATGATACAG
Reverse Primer: A22312_R TGGGGAAGAGACTTATTTTCAAC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
BY191770
BY191770
Y84307
Y84307
A21222
A21222
Y13568
Y13568
A1328
A1328
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies