Top » Catalog » SNPs » A22312

$18.00

A22312
[A22312]

A22312
hg38 Position: ChrY:19136399..19136399
Ancestral: T
Derived: G
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments:
Forward Primer: A22312_F TAGAGTCAGAGTCTATCAAAATGATACAG
Reverse Primer: A22312_R TGGGGAAGAGACTTATTTTCAAC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
FGC30452
FGC30452
Y91501
Y91501
Z17855
Z17855
BY153567
BY153567
A22770
A22770
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies