Top » Catalog » SNPs » BY42595

$18.00

BY42595
[BY42595]

BY42595
hg38 Position: ChrY:56887153..56887153
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: unknown
Comments: DYS655
Forward Primer: BY42595_F GCGTCCCAAGTAGCTAGGACTC
Reverse Primer: BY42595_R AATGTGGCCCATATACACCAG
Reviews

Customers who bought this product also purchased
DYF408
DYF408
DYS727
DYS727
DYF371X
DYF371X
DYS728
DYS728
DYS684
DYS684
DYF397
DYF397
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies