Top » Catalog » SNPs » BY42595

$18.00

BY42595
[BY42595]

BY42595
hg38 Position: ChrY:56887153..56887153
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: unknown
Comments: DYS655
Forward Primer: BY42595_F GCGTCCCAAGTAGCTAGGACTC
Reverse Primer: BY42595_R AATGTGGCCCATATACACCAG
Reviews

Customers who bought this product also purchased
BY160257
BY160257
BY40637
BY40637
BY160258
BY160258
DYS725
DYS725
DYR76
DYR76
CDY
CDY
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies