Top » Catalog » SNPs » BY132829

$18.00

BY132829
[BY132829]

BY132829
hg38 Position: ChrY:19264305..19264305
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: BY132829_F TTTTTGGAGGCAATAAGCAG
Reverse Primer: BY132829_R AGTTCTCCTGGGGAAGCAAC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies