Top » Catalog » SNPs » BY5400

$18.00

BY5400
[BY5400]

BY5400
hg38 Position: ChrY:18675469..18675469
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Below V13 > Z5018 > S2972 > Y18360
Forward Primer: BY5400_F ATCCCAATCGTAAGCTGCTG
Reverse Primer: BY5400_R ATCAATTTTTGCTCTGAAACAGTTC
Reviews

Customers who bought this product also purchased
E1b-A7136 Segregation Panel
E1b-A7136 Segregation Panel
FGC14185
FGC14185
Y18675
Y18675
Y18360
Y18360
BY5431
BY5431
A8458
A8458
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies