Top » Catalog » SNPs » FGC14185

$18.00

FGC14185
[FGC14185]

FGC14185
hg38 Position: ChrY:7098680..7098680
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: E1b
Comments: Below V13 > Z5018 > S2972
Forward Primer: FGC14185_F TATGAGCACAGTGTCCCAAAGAG
Reverse Primer: FGC14185_R ACCTACTGACCACTCTACTTATGCTTTC
Reviews

Customers who bought this product also purchased
A8458
A8458
E1b-A7136 Segregation Panel
E1b-A7136 Segregation Panel
Y18675
Y18675
Y18360
Y18360
BY5431
BY5431
BY5400
BY5400
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies