Top » Catalog » SNPs » Y18360

$18.00

Y18360
[Y18360]

Y18360
hg38 Position: ChrY:15978802..15978802
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: E1b
Comments: Below V13 > Z5018 > S2972 > A7135
Forward Primer: Y18360_F AAACAAGTGACTCACACATCCG
Reverse Primer: Y18360_R AATGGGGGGCTGAGATG
Reviews

Customers who bought this product also purchased
BY5400
BY5400
A8458
A8458
E1b-A7136 Segregation Panel
E1b-A7136 Segregation Panel
FGC14185
FGC14185
Y18675
Y18675
BY5431
BY5431
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies