Top » Catalog » SNPs » Y18675

$18.00

Y18675
[Y18675]

Y18675
hg38 Position: ChrY:13401529..13401529
Ancestral: A
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: E1b
Comments: Below V13 > Z5018 > S2972
Forward Primer: Y18675v2_F CTAGTACTCTATTGCAGGGGCAG
Reverse Primer: Y18675v2_R CGTTAGCTCACTGCAACCCT
Reviews

Customers who bought this product also purchased
BY5431
BY5431
BY5400
BY5400
A8458
A8458
E1b-A7136 Segregation Panel
E1b-A7136 Segregation Panel
FGC14185
FGC14185
Y18360
Y18360
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies