Top » Catalog » SNPs » L1336

$18.00

L1336
[L1336]

L1336
hg38 Position: ChrY:17261024..17261024
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1g3c
Comments: Found in a hg R-DF21 WTY participant
Forward Primer: L1336_F TATGAATATCACAGATGTCATGCTAGG
Reverse Primer: L1336_R CAAGGCTTCCACTCCTCTAAAC
Reviews (1)

Customers who bought this product also purchased
BY12129
BY12129
BY15554
BY15554
A6484
A6484
BY15559
BY15559
FGC11353
FGC11353
A935
A935
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies