Top » Catalog » SNPs » CTS8308

$18.00

CTS8308
[CTS8308]

CTS8308
hg38 Position: ChrY:15815794..15815794
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream of FGC11. FGC1723. and L859
Forward Primer: CTS8308_F GACATGGTGGCCTACACCTC
Reverse Primer: CTS8308_R GCCTGCTTCTGCTTACTTTCC
Reviews

Customers who bought this product also purchased
FGC12
FGC12
FGC11
FGC11
FGC1695
FGC1695
FGC1707
FGC1707
FGC8712
FGC8712
ZS2094
ZS2094
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies