Top » Catalog » SNPs » CTS8308

$18.00

CTS8308
[CTS8308]

CTS8308
hg38 Position: ChrY:15815794..15815794
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream of FGC11. FGC1723. and L859
Forward Primer: CTS8308_F GACATGGTGGCCTACACCTC
Reverse Primer: CTS8308_R GCCTGCTTCTGCTTACTTTCC
Reviews

Customers who bought this product also purchased
DYS513
DYS513
FGC38790
FGC38790
FT239596
FT239596
BY50476
BY50476
L858
L858
FGC5
FGC5
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies