Top » Catalog » SNPs » CTS8308

$18.00

CTS8308
[CTS8308]

CTS8308
hg38 Position: ChrY:15815794..15815794
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream of FGC11. FGC1723. and L859
Forward Primer: CTS8308_F GACATGGTGGCCTACACCTC
Reverse Primer: CTS8308_R GCCTGCTTCTGCTTACTTTCC
Reviews

Customers who bought this product also purchased
ZS2094
ZS2094
L859
L859
ZS10562
ZS10562
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS2085
ZS2085
FGC8715
FGC8715
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies