Top » Catalog » SNPs » FGC10492

$18.00

FGC10492
[FGC10492]

FGC10492
hg38 Position: ChrY:8573756..8573756
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream of FGC11. FGC1723. and L859
Forward Primer: FGC10492_F ACCTCCTCTTCCAATGCAAG
Reverse Primer: FGC10492_R AAGCAGAGGAAAATGATATGGG
Reviews

Customers who bought this product also purchased
FGC10493
FGC10493
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies