Top » Catalog » SNPs » Z16886

$18.00

Z16886
[Z16886]

Z16886
hg38 Position: ChrY:7752875..7752875
Ancestral: C
Derived: T
Reference: Gregory Magoon et al. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: downstream of S1026
Forward Primer: Z16886_F GGCAAGGAACTCTGGGTAGC
Reverse Primer: Z16886_R CTGTTGTGGGGTAAGGGAAG
Reviews

Customers who bought this product also purchased
A1101
A1101
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies