Top » Catalog » SNPs » Z16886

$18.00

Z16886
[Z16886]

Z16886
hg38 Position: ChrY:7752875..7752875
Ancestral: C
Derived: T
Reference: Gregory Magoon et al. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: downstream of S1026
Forward Primer: Z16886_F GGCAAGGAACTCTGGGTAGC
Reverse Primer: Z16886_R CTGTTGTGGGGTAAGGGAAG
Reviews

Customers who bought this product also purchased
DF49
DF49
U152
U152
S1026
S1026
DF19
DF19
DF13
DF13
L20
L20
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies