Top » Catalog » SNPs » FGC11150

$18.00

FGC11150
[FGC11150]

FGC11150
hg38 Position: ChrY:16106097..16106097
Ancestral: C
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b2a
Comments: FGC11134
Forward Primer: FGC11150_F TTGCAAATACATTGTTTGCTGAC
Reverse Primer: FGC11150_R TGGCATGCAACTGAAATTATTC
Reviews

Customers who bought this product also purchased
A2221
A2221
FGC29280
FGC29280
A150
A150
A195
A195
CTS4466
CTS4466
A804
A804
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies