Top » Catalog » SNPs » Z68

$18.00

Z68
[Z68]

Z68
hg38 Position: ChrY:18896437..18896437
Ancestral: C
Derived: T
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a2a1a2b1c (not listed)
Comments: Aka S485. approx. with R-Z49
Forward Primer: Z68_F CTGAGTGACCTAAAAAGAGACTTAGATG
Reverse Primer: Z68_R GAGTGAGATTCGTATTCTTGATTTCTC
Reviews

Customers who bought this product also purchased
BY25318
BY25318
FT410015
FT410015
BY25320
BY25320
BY169025
BY169025
BY171286
BY171286
BY38635
BY38635
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies