Top » Catalog » SNPs » FGC22182

$18.00

FGC22182
[FGC22182]

FGC22182
hg38 Position: ChrY:16819395..16819395
Ancestral: G
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a1a2a1a1a2b1
Comments: Below U106 > FGC3186 > FGC14877
Forward Primer: FGC22182_F AAGCAGATAAAAGTAATCTTGGGTTC
Reverse Primer: FGC22182_R AGGATGAGTTCAGTGGATGTAGC
Reviews

Customers who bought this product also purchased
A560
A560
FGC22189
FGC22189
FGC22185
FGC22185
FGC22184
FGC22184
FGC22183
FGC22183
FGC22179
FGC22179
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies