Top » Catalog » SNPs » FGC22183

$18.00

FGC22183
[FGC22183]

FGC22183
hg38 Position: ChrY:19636142..19636142
Ancestral: A
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a1 (not listed)
Comments: Below U106 > FGC3186 > FGC14877
Forward Primer: FGC22183_F TTCTAATTGCGCATGTTGAATC
Reverse Primer: FGC22183_R TATAGACCCAAGGCAAAGGTG
Reviews

Customers who bought this product also purchased
FGC22184
FGC22184
FGC22182
FGC22182
FGC22179
FGC22179
A561
A561
A560
A560
FGC22189
FGC22189
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies