Top » Catalog » SNPs » FGC22185

$18.00

FGC22185
[FGC22185]

FGC22185
hg38 Position: ChrY:20019725..20019725
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a1 (not listed)
Comments: Below U106 > FGC3186 > FGC14877
Forward Primer: FGC22185_F AATATGCACTCTCTTCCCATCTATG
Reverse Primer: FGC22185_R TGTTACAGCATGGTCTAGCACC
Reviews

Customers who bought this product also purchased
FGC22179
FGC22179
A561
A561
A560
A560
FGC22189
FGC22189
FGC22184
FGC22184
FGC22183
FGC22183
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies