Top » Catalog » SNPs » FGC22242

$18.00

FGC22242
[FGC22242]

FGC22242
hg38 Position: ChrY:8265381..8265381
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a1 (not listed)
Comments: Below U106 > FGC3186 > FGC14877
Forward Primer: FGC22242_F GAACTGAAGTTCTCACCTTCATACTG
Reverse Primer: FGC22242_R AAACTTATGCACACAGAAATCAGTG
Reviews

Customers who bought this product also purchased
A570
A570
A565
A565
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies