Top » Catalog » SNPs » BY30

$18.00

BY30
[BY30]

BY30
hg38 Position: ChrY:15333472..15333472
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: I2c (not listed)
Comments: Downstream L596 > S6716 > FGC18107 > S6656
Forward Primer: BY30_F CCAAGGAGGATGGGAAAG
Reverse Primer: BY30_R CCCTGGTACTCAGGTTCTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies