Top » Catalog » SNPs » A930

$18.00

A930
[A930]

A930
hg38 Position: ChrY:8034584..8034584
Ancestral: C
Derived: A
Reference: Hamma Bachir (2014)
ISOGG Haplogroup: E (not listed)
Comments: .
Forward Primer: A930_F ACAGCCCAGGAAATGTGC
Reverse Primer: A930_R TTGCAATCAGCGATATGTCAG
Reviews

Customers who bought this product also purchased
A429
A429
PF2581
PF2581
MZ89
MZ89
PF2548
PF2548
BY9954
BY9954
MZ149
MZ149
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies