Top » Catalog » SNPs » L596

$18.00

L596
[L596]

L596
hg38 Position: ChrY:12076925..12076925
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I2c
Comments: Found in a hg I-P215 WTY participant
Forward Primer: L596_F TGTGACCTCAGCTTTTACAATATCC
Reverse Primer: L596_R ACATGCTTTCAATGAATCAAGG
Reviews

Customers who bought this product also purchased
I2 Superclade Panel
I2 Superclade Panel
BY2811
BY2811
BY3335
BY3335
A1143
A1143
Y16665
Y16665
Y16682
Y16682
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies