Top » Catalog » SNPs » L596

$18.00

L596
[L596]

L596
hg38 Position: ChrY:12076925..12076925
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I2c
Comments: Found in a hg I-P215 WTY participant
Forward Primer: L596_F TGTGACCTCAGCTTTTACAATATCC
Reverse Primer: L596_R ACATGCTTTCAATGAATCAAGG
Reviews

Customers who bought this product also purchased
Y12341
Y12341
L161.1
L161.1
Y67661
Y67661
L145
L145
Y230195
Y230195
M172
M172
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies