Top » Catalog » SNPs » S15510

$18.00

S15510
[S15510]

S15510
hg38 Position: ChrY:12020389..12020389
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b5
Comments: Below Z2. parallel to Z7
Forward Primer: S15510_F TTCCTTCTAAAGTGAAACTAGCCTG
Reverse Primer: S15510_R GATAATATTCAGGAGTGTGGTATTCC
Reviews

Customers who bought this product also purchased
Z381
Z381
BZ7
BZ7
BZ809
BZ809
DNA Sample Kit
DNA Sample Kit
FGC918
FGC918
BZ2
BZ2
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies