Top » Catalog » SNPs » S15510

$18.00

S15510
[S15510]

S15510
hg38 Position: ChrY:12020389..12020389
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b5
Comments: Below Z2. parallel to Z7
Forward Primer: S15510_F TTCCTTCTAAAGTGAAACTAGCCTG
Reverse Primer: S15510_R GATAATATTCAGGAGTGTGGTATTCC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
FGC918
FGC918
BZ2
BZ2
L48
L48
S499
S499
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies