Top » Catalog » SNPs » YP745

$18.00

YP745
[YP745]

YP745
hg38 Position: ChrY:7324571..7324571
Ancestral: T
Derived: A
Reference: YFull (2014)
ISOGG Haplogroup: Q1b1a1a2
Comments: .
Forward Primer: YP745_F CATCTATGGACCTTGAGAACTTGTC
Reverse Primer: YP745_R GATGCTAGGATATAGGTGTAGACATACG
Reviews

Customers who bought this product also purchased
L56
L56
YP1237
YP1237
Q Superclade Panel
Q Superclade Panel
YP1251
YP1251
YP4585
YP4585
L275
L275
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies