Top » Catalog » SNPs » L555

$18.00

L555
[L555]

L555
hg38 Position: ChrY:7779294..7779294
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1j1
Comments: Found in a hg R-L21 WTY participant
Forward Primer: L555_F AAAATGATCCCTGTGAGATGTTAAC
Reverse Primer: L555_R GCCATTGAAAGCAAGATTGG
Reviews

Customers who bought this product also purchased
BY3015
BY3015
Z39589
Z39589
FGC19534
FGC19534
DF49
DF49
A2201
A2201
DF13
DF13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies