Top » Catalog » SNPs » L555

$18.00

L555
[L555]

L555
hg38 Position: ChrY:7779294..7779294
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1j1
Comments: Found in a hg R-L21 WTY participant
Forward Primer: L555_F AAAATGATCCCTGTGAGATGTTAAC
Reverse Primer: L555_R GCCATTGAAAGCAAGATTGG
Reviews

Customers who bought this product also purchased
DF13
DF13
A7792
A7792
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
FGC34554
FGC34554
L1335
L1335
BY3015
BY3015
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies