Top » Catalog » SNPs » S744

$18.00

S744
[S744]

S744
hg38 Position: ChrY:19959919..19959919
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1k1a
Comments: Downstream of L1335
Forward Primer: S744v2_F GACTACTCTCTCAGGGAGGATGAG
Reverse Primer: S744v2_R TTTGTTGTGCTGATAACAGTTGC
Reviews

Customers who bought this product also purchased
BY20833
BY20833
A858
A858
BY156842
BY156842
BY62303
BY62303
CTS697
CTS697
FGC32994
FGC32994
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies