Top » Catalog » SNPs » F1265

$18.00

F1265
[F1265]

F1265
hg38 Position: ChrY:8637276..8637276
Ancestral: G
Derived: A
Reference: Yan Shi (2011)
ISOGG Haplogroup: O (Investigation)
Comments: Found in a hg O2 person. Likely syn. to PK4. Also in R-M222
Forward Primer: F1265_F CCCTCAAGAAAATCCACTGC
Reverse Primer: F1265_R CCTGGAAACTGCAAACAACC
Reviews

Customers who bought this product also purchased
A13155
A13155
BY205
BY205
DF13
DF13
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
FGC29785
FGC29785
FGC29783
FGC29783
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies