Top » Catalog » SNPs » CTS4466

$18.00

CTS4466
[CTS4466]

CTS4466
hg38 Position: ChrY:13548615..13548615
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b
Comments: Aka S1136; downstream L21
Forward Primer: trA_CTS4466_F CCTGTATCAGCCTCCCAAAC
Reverse Primer: trP1_CTS4466_R CCACCCAAGAAACACCAAAC
Reviews

Customers who bought this product also purchased
BY16788
BY16788
BY16789
BY16789
DF13
DF13
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
BY140
BY140
A7754
A7754
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies