Top » Catalog » SNPs » S1105

$18.00

S1105
[S1105]

S1105
hg38 Position: ChrY:19066620..19066620
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of FGC5496 S1088
Forward Primer: S1105_F CCTGAGGAAGGACGATTTCC
Reverse Primer: S1105_R AGCCCTCCACAGTTATGCTG
Reviews

Customers who bought this product also purchased
FGC5494
FGC5494
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
FGC5496
FGC5496
DF21
DF21
A178
A178
Z255
Z255
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies