Top » Catalog » SNPs » S1105

$18.00

S1105
[S1105]

S1105
hg38 Position: ChrY:19066620..19066620
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of FGC5496 S1088
Forward Primer: S1105_F CCTGAGGAAGGACGATTTCC
Reverse Primer: S1105_R AGCCCTCCACAGTTATGCTG
Reviews

Customers who bought this product also purchased
Z39589
Z39589
A2121
A2121
L513
L513
FGC7448
FGC7448
DF49
DF49
A194
A194
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies