Top » Catalog » SNPs » S11121

$18.00

S11121
[S11121]

S11121
hg38 Position: ChrY:8324814..8324814
Ancestral: G
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b-DF27 (not listed)
Comments: Under L176.2+. found in 6/10 of the SRY2627- samples
Forward Primer: S11121_F CTCATGCCTGTCCCGTATG
Reverse Primer: S11121_R CGATGAAAGACAAAGTAAGTCCTG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
S8825
S8825
Y31346
Y31346
FGC20767
FGC20767
Z1899
Z1899
FGC39110
FGC39110
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies