Top » Catalog » SNPs » S1121

$18.00

S1121
[S1121]

S1121
hg38 Position: ChrY:12855070..12855070
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1
Comments: .
Forward Primer: S1121v2_F TCCTTACAAACATAAGCTTGAAGTG
Reverse Primer: S1121v2_R ATGCAAAAATTAGCCAGGCA
Reviews

Customers who bought this product also purchased
A10641
A10641
L21
L21
A9005
A9005
A6508
A6508
A12017
A12017
A2295
A2295
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies