Top » Catalog » SNPs » S1121

$18.00

S1121
[S1121]

S1121
hg38 Position: ChrY:12855070..12855070
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1
Comments: Below FGC11134 > CTS4466 > A541
Forward Primer: S1121v2_F TCCTTACAAACATAAGCTTGAAGTG
Reverse Primer: S1121v2_R ATGCAAAAATTAGCCAGGCA
Reviews

Customers who bought this product also purchased
BY16028
BY16028
BY3863
BY3863
FT43021
FT43021
BY39364
BY39364
BY39361
BY39361
BY39363
BY39363
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies