Top » Catalog » SNPs » S588

$18.00

S588
[S588]

S588
hg38 Position: ChrY:14233992..14233992
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a2
Comments: Downstream DF105
Forward Primer: S588_F CCTGAAACTTTTGCCACAAAC
Reverse Primer: S588_R CAGGGCTCGAGATTTAATTTG
Reviews

Customers who bought this product also purchased
FGC59201
FGC59201
FGC33214
FGC33214
FGC19842
FGC19842
FGC30115
FGC30115
FGC19852
FGC19852
A1147
A1147
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies