Top » Catalog » SNPs » S588

$18.00

S588
[S588]

S588
hg38 Position: ChrY:14233992..14233992
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a2
Comments: Downstream DF105
Forward Primer: S588_F CCTGAAACTTTTGCCACAAAC
Reverse Primer: S588_R CAGGGCTCGAGATTTAATTTG
Reviews

Customers who bought this product also purchased
BY159752
BY159752
M343
M343
M173
M173
M9
M9
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
FGC59201
FGC59201
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies