Top » Catalog » SNPs » S588

$18.00

S588
[S588]

S588
hg38 Position: ChrY:14233992..14233992
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a2
Comments: Downstream DF105
Forward Primer: S588_F CCTGAAACTTTTGCCACAAAC
Reverse Primer: S588_R CAGGGCTCGAGATTTAATTTG
Reviews

Customers who bought this product also purchased
P312
P312
Y150210
Y150210
BY108617
BY108617
FGC32795
FGC32795
L51
L51
A23675
A23675
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies