Top » Catalog » SNPs » S588

$18.00

S588
[S588]

S588
hg38 Position: ChrY:14233992..14233992
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a2
Comments: Downstream DF105
Forward Primer: S588_F CCTGAAACTTTTGCCACAAAC
Reverse Primer: S588_R CAGGGCTCGAGATTTAATTTG
Reviews

Customers who bought this product also purchased
A984
A984
A10528
A10528
A4697
A4697
FGC19845
FGC19845
BY18130
BY18130
FGC13618
FGC13618
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies