Top » Catalog » SNPs » DF13

$18.00

DF13
[DF13]

DF13
hg38 Position: ChrY:2968390..2968390
Ancestral: A
Derived: C
Reference: Gregory Magoon (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c1
Comments: Almost everything below R-L21
Forward Primer: DF13v4_F GTGGCATGATGTGCAAATATG
Reverse Primer: DF13v4_R GCACTGATGTATCTCAAGACTTGAC
Reviews

Customers who bought this product also purchased
S1105
S1105
A2501
A2501
FGC46309
FGC46309
Y150210
Y150210
A10528
A10528
BY108617
BY108617
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies