Top » Catalog » SNPs » DF13

$18.00

DF13
[DF13]

DF13
hg38 Position: ChrY:2968390..2968390
Ancestral: A
Derived: C
Reference: Gregory Magoon (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c1
Comments: Almost everything below R-L21
Forward Primer: DF13v4_F GTGGCATGATGTGCAAATATG
Reverse Primer: DF13v4_R GCACTGATGTATCTCAAGACTTGAC
Reviews

Customers who bought this product also purchased
CTS5396
CTS5396
BY246
BY246
A2070
A2070
S7834
S7834
Z17819
Z17819
BY11195
BY11195
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies