Top » Catalog » SNPs » DF13

$18.00

DF13
[DF13]

DF13
hg38 Position: ChrY:2968390..2968390
Ancestral: A
Derived: C
Reference: Gregory Magoon (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c1
Comments: Almost everything below R-L21
Forward Primer: DF13v4_F GTGGCATGATGTGCAAATATG
Reverse Primer: DF13v4_R GCACTGATGTATCTCAAGACTTGAC
Reviews

Customers who bought this product also purchased
A7907
A7907
R1b-DF27 Panel
R1b-DF27 Panel
ZP179
ZP179
FGC20797
FGC20797
A13152
A13152
FGC41901
FGC41901
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies