Top » Catalog » SNPs » S590

$18.00

S590
[S590]

S590
hg38 Position: ChrY:17298578..17298578
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Downstream S603
Forward Primer: S590_F TCAACCCAGACACATCCTTC
Reverse Primer: S590_R TGTTGATGAAAAGAGCCAAATTC
Reviews

Customers who bought this product also purchased
FGC19830
FGC19830
FGC19838
FGC19838
FGC19833
FGC19833
FGC13618
FGC13618
FGC23595
FGC23595
FGC4109
FGC4109
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS388
1 x DYS575
$19.90
Haplogroup Info
Other products
Currencies