Top » Catalog » SNPs » S603

$18.00

S603
[S603]

S603
hg38 Position: ChrY:11859135..11859135
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a2b
Comments: Downstream of S588
Forward Primer: S603v2_F AGTTCAATTCCTGGGTAAGGG
Reverse Primer: S603v2_R AGAGATTTTGTCACCACCAGATC
Reviews

Customers who bought this product also purchased
Y9391
Y9391
Y81784
Y81784
A17594
A17594
FGC10147
FGC10147
FGC16741
FGC16741
A5386
A5386
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies