Top » Catalog » SNPs » DF41

$18.00

DF41
[DF41]

DF41
hg38 Position: ChrY:14880722..14880722
Ancestral: T
Derived: C
Reference: http://dna-forums.com
ISOGG Haplogroup: R1b1a1a2a1a2c1i
Comments: Found in R-L21 (x L513 DF21 DF23 Z255 Z253) samples
Forward Primer: DF41_F ATTGGAGAATGGAAACGTCC
Reverse Primer: DF41_R TGGAGAATGGTTAGATGGGG
Reviews

Customers who bought this product also purchased
A10528
A10528
BY108617
BY108617
A18726
A18726
FGC32795
FGC32795
ZS8379
ZS8379
A10642
A10642
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies